
INCREASE OF DMPK AND DECREASE OF DMAHP
GENE EXPRESSION IN MUSCLE AND BLOOD OF
MYOTONIC DYSTROPHY PATIENTS COMPARED
TO NORMAL SUBJECTS
Chronopoulou P1, Yapijakis C1, Karadimas C1, Panas M1,
Manta P1, Cariolou M2, Vassilopoulos D1
*Corresponding Author: Christos Yapijakis, D.M.D., M.S., Ph.D., Clinical and Molecular Neurogenetics Unit, Department of Neurology, University of Athens Medical School, Eginition Hospital, Athens 11528, Greece; Tel: +30-10-728-9125; Fax: +30-1-881-1243; E-mail: cyapijakis_ua_gr.yahoo.com
page: 29
|
|
MATERIALS AND METHODS
Source of muscle biopsies and blood samples. Total RNA was isolated from muscle biopsies and blood samples of seven DM patients and three controls. DM patients had an expanded allele of 80-940 CTG repeats, in addition to a normal range allele. The individuals who were considered as controls did not have the DM mutation, nor did they display any DM symptoms. A muscle biopsy had been taken from two of them because of a possible myopathic disorder, but the pathological examination did not reveal any specific findings. One turned out to be a female carrier of a mutation for Duchenne muscular dystrophy. The third person was a normal individual whose sample was taken during a hernia operation.
Total RNA extraction and Dnase I treatment. RNA was extracted from blood and skeletal muscle using the Rnazol B method [17]. Total RNA was incubated with Dnase I (GIBCO BRL, Gaithersburg, MD, USA) at room temperature for 30 minutes and then underwent an enzyme denaturation step at 95°C for 5 minutes.
Cis RT-PCR: 200 ng of Dnase I-treated RNA was used in a 20 mL reaction containing 50 ng of each of the downstream primers, RT2, DM102, RT4 and RT5 (Fig. 1, Table 1), 50 mM Tris-HCl (pH 8.0), 75 mM KCl, 3 mM MgCl2, 10 mM DTT, 1 mM each dNTP, 20 U of RNA Guard, 20 U of M-MLV reverse transcriptase (Pharmacia, Uppsala, Sweden). The reaction was incubated at 37°C for 60 minutes and then added to a standard PCR reaction of 50 ?L containing 50 ng of both downstream (mentioned above) and upstream primers RT1, DM101 and RT3 (Fig. 1, Table 1). Amplification conditions were: initial denaturation at 94°C for 3 minutes, denaturation for 30 cycles at 94°C for 1 minute, annealing at 55°C for 1 minute, elongation at 72°C for 1 minute, and a final extension step at 72°C for 4 minutes. The multiplex RT-PCR products were seen on 2% 3:1 NuSieve (FMC BioProducts, Rockland, ME, USA) agarose gel after ethidium bromide staining.
Allele-specific Bpm I polymorphism in normal and mutant DMPK transcripts was detected as previously described [7]. Ten ?L of RT-PCR using primers RT3 and RT4 (Fig. 1, Table 1) were digested for 1 hour at 37°C with 3 U of Bpm I (Gsu I) in the manufacturer’s (Fermentas, Vilnius, Lithuania) buffer. Total digests were analyzed by gel electrophoresis through 3% agarose.
Quantitative RT-PCR were performed with the cis RT-PCR protocol using 25, 50, 200 and 400 ng of Dnase I-treated RNA and end-labeled upstream primers for 22 cycles. All other conditions were as previously described. The radioactive products were electrophoresed on a 6% polyacrylamide gel and revealed by autoradiography. A plateau was reached at 200 ng with the conditions used.
TransRT-PCR: 2.5 ?g total RNA was reverse transcribed using 5 U AMV reverse transcriptase and random hexanucleotides (Amersham Pharmacia Biotech, Little Chalfont, Buckinghamshire, UK). The RT-PCR product (200 ng) was included in a PC reaction, that used 100 ng of each primer in two sets (Fig. 1, Table 1): one set for DMPK (RT1, RT2), or DMAHP (DMAHPF, DMAHPR) genes, and one set for the control genes of triose phosphate isomerase (tpi, TPI1F, TPI1R) and b-globin (5' globin, 3' globin). Amplification was carried out using a GIBCO BRL Taq DNA polymerase with 30 cycles of 30 seconds at 94°C, 30 seconds at 55°C, 30 seconds at 72°C, 7 minutes extension in the manufacturer’s (GIBCO BRL) buffer containing 2 U Taq polymerase, 0.2 ?M each primer, 1.25 mM dNTPs, 1.5 mM MgCl2 in a 50 ?L reaction volume. Amplification was carried out in a Touch Down thermocycler (Hybaid, Teddington, UK) and the PCR products were separated in a 4% agarose gel and stained with ethidium bromide. The relative density of the bands was measured using the Image Quantitative 1.1 program.
Conformational fragment length polymorphism (CFLP) analysis was performed using the CFLPscanO kit from Boehringer Mannheim (Mannheim, Germany) according to the manufacturer’s recommendations. Amplification was carried out using primer sets PD1F-PD1R, PD2F-PD2R and PD3F-PD3R (Fig. 1, Table 1) in a radioactive PCR of 35 cycles and an annealing temperature of 63°C.
.jpg)
Figure 1. Schematic structural organization of the DM region showing part of the DMPK gene, as well as the DMAHP gene (not drawn to scale). The location of the (CTG)n expansion within the 3'UTR of DMPK and the (polyadenylation) poly A site are both shown. Exons are indicated in gray boxes and their translated regions are dashed. The location and orientation of the primers used in this study are schematically shown (not drawn to scale). All primers were commercially synthesized from Research GeneticsO (Huntsville, AL, USA) (Table 1). The design of primers not previously reported was done using the “ primer 3” program from MIT (Cambridge, MA, USA).
Primer |
Primer Sequence (5'®3) |
Product Size (bp) |
Reference |
DMRT1 |
CTCCGAGAGCAGCGCAAGTGA |
152 |
[7] |
DMRT2 |
GTTCGCAAAGTGCAAAGTCT |
|
[7] |
DMRT3 |
CATCCTGTGGGGACACCGAGG |
|
[7] |
DMRT4 |
CTGTCGGACATTCGGGAAGGT |
187 (RT3-RT4) |
[7] |
DMRT5 |
CTGCAGAAGGTTTAGAAAGAGC |
354 (RT3-RT5) |
[7] |
DMAHPF |
AGTGGACAAGTATCGACTGC |
137 |
[12] |
DMAHPR |
GCGTGGGGTAGCGGTTGCC |
|
[12] |
PD1F |
GGTCGGCCAGAAAGAAGAT |
1019 |
This study |
PD1R |
GAGATTGTGAGCTGTCCCG |
|
This study |
PD2F |
CTGGAATGATCCACCGAAAC |
1033 |
This study |
PD2R |
GACCTTGCCAGGGATGGGAGATG |
|
This study |
PD3F |
CAGTCATCTCGGAGAGAGGGAG |
900 |
This study |
PF3R |
GTCTTCAGCAACCGCATTTC |
|
This study |
DM101 |
CTTCCCAGGCCTGCAGTTTGCCGATC |
146 (CTG)11 |
[2] |
DM102 |
GAACGGGGCTCGAAGGGTCCTTGTAGC |
|
[2] |
TPI1F |
CCCTGGCATGATCAAAGACT |
227 |
This study |
TPI1R |
TCTGCGATGACCTTTGTCTG |
|
This study |
5' Globin |
ACTAGCAACCTCAAACAGACACCATG |
383 |
This study |
3' Globin |
GCCAAAGTGATGGGCCAGCACACAGACCA |
|
This study |
Table 1. PCR primers for RT-PCR and CFLP used in this study (the primer pairs are cited in the text)
|
|
|
|



 |
Number 28 Vol 28 2025 Supplement |
Number 27 VOL. 27 (2), 2024 |
Number 27 VOL. 27 (1), 2024 |
Number 26 Number 26 VOL. 26(2), 2023 All in one |
Number 26 VOL. 26(2), 2023 |
Number 26 VOL. 26, 2023 Supplement |
Number 26 VOL. 26(1), 2023 |
Number 25 VOL. 25(2), 2022 |
Number 25 VOL. 25 (1), 2022 |
Number 24 VOL. 24(2), 2021 |
Number 24 VOL. 24(1), 2021 |
Number 23 VOL. 23(2), 2020 |
Number 22 VOL. 22(2), 2019 |
Number 22 VOL. 22(1), 2019 |
Number 22 VOL. 22, 2019 Supplement |
Number 21 VOL. 21(2), 2018 |
Number 21 VOL. 21 (1), 2018 |
Number 21 VOL. 21, 2018 Supplement |
Number 20 VOL. 20 (2), 2017 |
Number 20 VOL. 20 (1), 2017 |
Number 19 VOL. 19 (2), 2016 |
Number 19 VOL. 19 (1), 2016 |
Number 18 VOL. 18 (2), 2015 |
Number 18 VOL. 18 (1), 2015 |
Number 17 VOL. 17 (2), 2014 |
Number 17 VOL. 17 (1), 2014 |
Number 16 VOL. 16 (2), 2013 |
Number 16 VOL. 16 (1), 2013 |
Number 15 VOL. 15 (2), 2012 |
Number 15 VOL. 15, 2012 Supplement |
Number 15 Vol. 15 (1), 2012 |
Number 14 14 - Vol. 14 (2), 2011 |
Number 14 The 9th Balkan Congress of Medical Genetics |
Number 14 14 - Vol. 14 (1), 2011 |
Number 13 Vol. 13 (2), 2010 |
Number 13 Vol.13 (1), 2010 |
Number 12 Vol.12 (2), 2009 |
Number 12 Vol.12 (1), 2009 |
Number 11 Vol.11 (2),2008 |
Number 11 Vol.11 (1),2008 |
Number 10 Vol.10 (2), 2007 |
Number 10 10 (1),2007 |
Number 9 1&2, 2006 |
Number 9 3&4, 2006 |
Number 8 1&2, 2005 |
Number 8 3&4, 2004 |
Number 7 1&2, 2004 |
Number 6 3&4, 2003 |
Number 6 1&2, 2003 |
Number 5 3&4, 2002 |
Number 5 1&2, 2002 |
Number 4 Vol.3 (4), 2000 |
Number 4 Vol.2 (4), 1999 |
Number 4 Vol.1 (4), 1998 |
Number 4 3&4, 2001 |
Number 4 1&2, 2001 |
Number 3 Vol.3 (3), 2000 |
Number 3 Vol.2 (3), 1999 |
Number 3 Vol.1 (3), 1998 |
Number 2 Vol.3(2), 2000 |
Number 2 Vol.1 (2), 1998 |
Number 2 Vol.2 (2), 1999 |
Number 1 Vol.3 (1), 2000 |
Number 1 Vol.2 (1), 1999 |
Number 1 Vol.1 (1), 1998 |
|
|
|