
ADIPOCYTE “FATTY ACID BINDING PROTEIN”
GENE POLYMORPHISMS (rs1054135, rs16909196
AND rs16909187) IN JORDANIANS WITH OBESITY
AND TYPE 2 DIABETES MELLITUS El-Ryalat S.W.1, Irshaid Y.M.1*, Abujbara M.2, El-Khateeb M.2, Ajlouni K.M.2 *Corresponding Author: Prof. Yacoub M. Irshaid MD, PhD, Department of Pharmacology, College of
Medicine, The University of Jordan, Amman 11942, Jordan. Phone No.: +962 777818284,
Fax No.: +962 6 5300820, Email Addresses: y.irshaid@ju.edu.jo page: 63
|
|
MATERIALS AND METHODS
Subjects:
A total of 397 Jordanians were enrolled in the study.
They were recruited from the National Center for Diabetes,
Endocrinology and Genetics (NCDEG), Amman,
Jordan. The study protocol was approved by The NCDEG
Institutional Review Board. A written and signed consent
form had been obtained from each participant before blood
sampling and data collection.
Study design:
This study was a cross sectional study where the study
population has been divided into four groups: Group 1 constituted
type 2 adult diabetic patients who are either obese
or over-weight (BMI>25 kg/m²). Group 2 patients were
type 2 adult diabetic patients with normal body weight
(BMI<25 kg/m²). Group 3 patients were overweight and
obese adults (BMI>25 kg/m²) with normal serum glucose
and HBA1c < 5.7. Group 4 patients were normal weight
adults (BMI<25 kg/m²) with normal serum glucose and
(HBA1c < 5.7) and served as the control group.
Every subject donated 3-5 mL of venous blood in
EDTA tubes. Genomic DNA Extraction:
Genomic DNA was extracted in the same day of
blood withdrawal using Promega-Wizard (USA) genomic
purification kit, according to the manufacturer recommendations.
The absorbance was measured at a 260 nm
wavelength (A260) by using Nano Drop Spectrophotometer
(Thermo Fisher, USA) in the NCDEG and the ratio
of the absorbance at A260/A280 nm wavelengths was
measured. DNA extraction was considered adequate when
the ratio was between 1.6-1.8 [19]. The concentration of
all DNA samples were also measured. The precise length
of genomic DNA was determined by gel electrophoresis
using 1% agarose gel.
Genomic amplification by PCR:
The FABP4 sequence containing (rs1054135,
rs16909196 and rs16909187) SNPs was amplified by
PCR followed by sequencing of the PCR product. The
primers sequences were: CACGAGAGTTTATGAGAGAGC
for forward primer and GCAACGCACTAAGACAGAG for
reverse primer. Primers were designed by DNA-MAN
program (www.lynnon.com/dnaman.html) and both selectivity
and specificity were checked.
The PCR protocol constituted initial denaturation at
95ºC for 5 minutes followed by 39 cycles of denaturation
at 95ºC for 30 seconds, annealing at 55ºC for 30 seconds,
extension at 72ºC for 45 seconds and final extension at
72ºC for 7 minutes.
PCR products were visualized using agarose gel run
in a tris-borate-EDTA (TBE) buffer. The agarose gel was
stained using RedSafe™ dye, and PCR products’ bands
were detected by loading them in the stained agarose gel
that was placed under UV light. A 100-1500 base pair
(bp) ladder (New England Biolabs, USA) was used as a
marker to estimate the size of the amplified product. PCR
products were sent for DNA Sanger Sequencing Analysis
to Macrogen, South Korea. PCR product size was 530 bp.
Statistical analysis:
χ2 was calculated using an online calculator for 2x2
contingency tables at http://www.socscistatistics.com/tests/
chisquare/Default2.aspx. The odds ratios were calculated
using the online statistical software available at https://www.
medcalc.org/calc/odds_ratio.php. The Hardy-Weinberg equilibrium
was assessed using the online calculator at https://
www.wolframalpha.com/widgets/view.jsp?id=2fefa8b126
607e29fe2990c722ee6cae. This final site calculates the parameter
X. When X is greater or equal to zero, then there are
significant differences between the observed and expected
genotype frequencies, and the genotypes are not in Hardy-
Weinberg equilibrium. The linkage disequilibrium (LD)
analysis and estimation of haplotype diversity among the
various groups were performed using Haploview 4.2 population
genetic analysis software at https://haploview.software.
informer.com/4.2/. The LD between the genetic variants was
measured using Dʹand correlation coefficient (r2).
|
|
|
|



 |
Number 28 Vol 28 2025 Supplement |
Number 27 VOL. 27 (2), 2024 |
Number 27 VOL. 27 (1), 2024 |
Number 26 Number 26 VOL. 26(2), 2023 All in one |
Number 26 VOL. 26(2), 2023 |
Number 26 VOL. 26, 2023 Supplement |
Number 26 VOL. 26(1), 2023 |
Number 25 VOL. 25(2), 2022 |
Number 25 VOL. 25 (1), 2022 |
Number 24 VOL. 24(2), 2021 |
Number 24 VOL. 24(1), 2021 |
Number 23 VOL. 23(2), 2020 |
Number 22 VOL. 22(2), 2019 |
Number 22 VOL. 22(1), 2019 |
Number 22 VOL. 22, 2019 Supplement |
Number 21 VOL. 21(2), 2018 |
Number 21 VOL. 21 (1), 2018 |
Number 21 VOL. 21, 2018 Supplement |
Number 20 VOL. 20 (2), 2017 |
Number 20 VOL. 20 (1), 2017 |
Number 19 VOL. 19 (2), 2016 |
Number 19 VOL. 19 (1), 2016 |
Number 18 VOL. 18 (2), 2015 |
Number 18 VOL. 18 (1), 2015 |
Number 17 VOL. 17 (2), 2014 |
Number 17 VOL. 17 (1), 2014 |
Number 16 VOL. 16 (2), 2013 |
Number 16 VOL. 16 (1), 2013 |
Number 15 VOL. 15 (2), 2012 |
Number 15 VOL. 15, 2012 Supplement |
Number 15 Vol. 15 (1), 2012 |
Number 14 14 - Vol. 14 (2), 2011 |
Number 14 The 9th Balkan Congress of Medical Genetics |
Number 14 14 - Vol. 14 (1), 2011 |
Number 13 Vol. 13 (2), 2010 |
Number 13 Vol.13 (1), 2010 |
Number 12 Vol.12 (2), 2009 |
Number 12 Vol.12 (1), 2009 |
Number 11 Vol.11 (2),2008 |
Number 11 Vol.11 (1),2008 |
Number 10 Vol.10 (2), 2007 |
Number 10 10 (1),2007 |
Number 9 1&2, 2006 |
Number 9 3&4, 2006 |
Number 8 1&2, 2005 |
Number 8 3&4, 2004 |
Number 7 1&2, 2004 |
Number 6 3&4, 2003 |
Number 6 1&2, 2003 |
Number 5 3&4, 2002 |
Number 5 1&2, 2002 |
Number 4 Vol.3 (4), 2000 |
Number 4 Vol.2 (4), 1999 |
Number 4 Vol.1 (4), 1998 |
Number 4 3&4, 2001 |
Number 4 1&2, 2001 |
Number 3 Vol.3 (3), 2000 |
Number 3 Vol.2 (3), 1999 |
Number 3 Vol.1 (3), 1998 |
Number 2 Vol.3(2), 2000 |
Number 2 Vol.1 (2), 1998 |
Number 2 Vol.2 (2), 1999 |
Number 1 Vol.3 (1), 2000 |
Number 1 Vol.2 (1), 1999 |
Number 1 Vol.1 (1), 1998 |
|
|
|