ADIPOCYTE “FATTY ACID BINDING PROTEIN” GENE POLYMORPHISMS (rs1054135, rs16909196 AND rs16909187) IN JORDANIANS WITH OBESITY AND TYPE 2 DIABETES MELLITUS
El-Ryalat S.W.1, Irshaid Y.M.1*, Abujbara M.2, El-Khateeb M.2, Ajlouni K.M.2
*Corresponding Author: Prof. Yacoub M. Irshaid MD, PhD, Department of Pharmacology, College of Medicine, The University of Jordan, Amman 11942, Jordan. Phone No.: +962 777818284, Fax No.: +962 6 5300820, Email Addresses: y.irshaid@ju.edu.jo
page: 63

MATERIALS AND METHODS

Subjects: A total of 397 Jordanians were enrolled in the study. They were recruited from the National Center for Diabetes, Endocrinology and Genetics (NCDEG), Amman, Jordan. The study protocol was approved by The NCDEG Institutional Review Board. A written and signed consent form had been obtained from each participant before blood sampling and data collection. Study design: This study was a cross sectional study where the study population has been divided into four groups: Group 1 constituted type 2 adult diabetic patients who are either obese or over-weight (BMI>25 kg/m²). Group 2 patients were type 2 adult diabetic patients with normal body weight (BMI<25 kg/m²). Group 3 patients were overweight and obese adults (BMI>25 kg/m²) with normal serum glucose and HBA1c < 5.7. Group 4 patients were normal weight adults (BMI<25 kg/m²) with normal serum glucose and (HBA1c < 5.7) and served as the control group. Every subject donated 3-5 mL of venous blood in EDTA tubes. Genomic DNA Extraction: Genomic DNA was extracted in the same day of blood withdrawal using Promega-Wizard (USA) genomic purification kit, according to the manufacturer recommendations. The absorbance was measured at a 260 nm wavelength (A260) by using Nano Drop Spectrophotometer (Thermo Fisher, USA) in the NCDEG and the ratio of the absorbance at A260/A280 nm wavelengths was measured. DNA extraction was considered adequate when the ratio was between 1.6-1.8 [19]. The concentration of all DNA samples were also measured. The precise length of genomic DNA was determined by gel electrophoresis using 1% agarose gel. Genomic amplification by PCR: The FABP4 sequence containing (rs1054135, rs16909196 and rs16909187) SNPs was amplified by PCR followed by sequencing of the PCR product. The primers sequences were: CACGAGAGTTTATGAGAGAGC for forward primer and GCAACGCACTAAGACAGAG for reverse primer. Primers were designed by DNA-MAN program (www.lynnon.com/dnaman.html) and both selectivity and specificity were checked. The PCR protocol constituted initial denaturation at 95ºC for 5 minutes followed by 39 cycles of denaturation at 95ºC for 30 seconds, annealing at 55ºC for 30 seconds, extension at 72ºC for 45 seconds and final extension at 72ºC for 7 minutes. PCR products were visualized using agarose gel run in a tris-borate-EDTA (TBE) buffer. The agarose gel was stained using RedSafe™ dye, and PCR products’ bands were detected by loading them in the stained agarose gel that was placed under UV light. A 100-1500 base pair (bp) ladder (New England Biolabs, USA) was used as a marker to estimate the size of the amplified product. PCR products were sent for DNA Sanger Sequencing Analysis to Macrogen, South Korea. PCR product size was 530 bp. Statistical analysis: χ2 was calculated using an online calculator for 2x2 contingency tables at http://www.socscistatistics.com/tests/ chisquare/Default2.aspx. The odds ratios were calculated using the online statistical software available at https://www. medcalc.org/calc/odds_ratio.php. The Hardy-Weinberg equilibrium was assessed using the online calculator at https:// www.wolframalpha.com/widgets/view.jsp?id=2fefa8b126 607e29fe2990c722ee6cae. This final site calculates the parameter X. When X is greater or equal to zero, then there are significant differences between the observed and expected genotype frequencies, and the genotypes are not in Hardy- Weinberg equilibrium. The linkage disequilibrium (LD) analysis and estimation of haplotype diversity among the various groups were performed using Haploview 4.2 population genetic analysis software at https://haploview.software. informer.com/4.2/. The LD between the genetic variants was measured using Dʹand correlation coefficient (r2).



Number 28
Vol 28 2025 Supplement
Number 27
VOL. 27 (2), 2024
Number 27
VOL. 27 (1), 2024
Number 26
Number 26 VOL. 26(2), 2023 All in one
Number 26
VOL. 26(2), 2023
Number 26
VOL. 26, 2023 Supplement
Number 26
VOL. 26(1), 2023
Number 25
VOL. 25(2), 2022
Number 25
VOL. 25 (1), 2022
Number 24
VOL. 24(2), 2021
Number 24
VOL. 24(1), 2021
Number 23
VOL. 23(2), 2020
Number 22
VOL. 22(2), 2019
Number 22
VOL. 22(1), 2019
Number 22
VOL. 22, 2019 Supplement
Number 21
VOL. 21(2), 2018
Number 21
VOL. 21 (1), 2018
Number 21
VOL. 21, 2018 Supplement
Number 20
VOL. 20 (2), 2017
Number 20
VOL. 20 (1), 2017
Number 19
VOL. 19 (2), 2016
Number 19
VOL. 19 (1), 2016
Number 18
VOL. 18 (2), 2015
Number 18
VOL. 18 (1), 2015
Number 17
VOL. 17 (2), 2014
Number 17
VOL. 17 (1), 2014
Number 16
VOL. 16 (2), 2013
Number 16
VOL. 16 (1), 2013
Number 15
VOL. 15 (2), 2012
Number 15
VOL. 15, 2012 Supplement
Number 15
Vol. 15 (1), 2012
Number 14
14 - Vol. 14 (2), 2011
Number 14
The 9th Balkan Congress of Medical Genetics
Number 14
14 - Vol. 14 (1), 2011
Number 13
Vol. 13 (2), 2010
Number 13
Vol.13 (1), 2010
Number 12
Vol.12 (2), 2009
Number 12
Vol.12 (1), 2009
Number 11
Vol.11 (2),2008
Number 11
Vol.11 (1),2008
Number 10
Vol.10 (2), 2007
Number 10
10 (1),2007
Number 9
1&2, 2006
Number 9
3&4, 2006
Number 8
1&2, 2005
Number 8
3&4, 2004
Number 7
1&2, 2004
Number 6
3&4, 2003
Number 6
1&2, 2003
Number 5
3&4, 2002
Number 5
1&2, 2002
Number 4
Vol.3 (4), 2000
Number 4
Vol.2 (4), 1999
Number 4
Vol.1 (4), 1998
Number 4
3&4, 2001
Number 4
1&2, 2001
Number 3
Vol.3 (3), 2000
Number 3
Vol.2 (3), 1999
Number 3
Vol.1 (3), 1998
Number 2
Vol.3(2), 2000
Number 2
Vol.1 (2), 1998
Number 2
Vol.2 (2), 1999
Number 1
Vol.3 (1), 2000
Number 1
Vol.2 (1), 1999
Number 1
Vol.1 (1), 1998

 

 


 About the journal ::: Editorial ::: Subscription ::: Information for authors ::: Contact
 Copyright © Balkan Journal of Medical Genetics 2006