KERATITIS-ICHTHYOSIS-DEAFNESS SYNDROME WITH HETEROZYGOUS P.D50N IN THE GJB2 GENE IN TWO SERBIAN ADULT PATIENTS
Kalezić T.1,*, Vuković I.2, Stojković M.1, Stanojlović S.1, Karanović J.3, Brajušković G.3, Savić-Pavićević D.3
*Corresponding Author: Tanja Kalezić, School of Medicine, University of Belgrade; Clinic for Eye Disease, University Clinical Centre of Serbia, Address: Pasterova Street No 2 , Tel. +381638148843, e-mail address: tanjakalezic@gmail.com
page: 6

PATIENTS AND METHODS

Two unrelated patients with KID syndrome were studied. Clinical diagnosis was based on dermatological, hearing and ophthalmological examinations, and confirmed by molecular genetic analysis of the GJB2 gene. Molecular genetic testing for GJB2 mutations was done for both patients and their unaffected first-degree relatives (mother and sister), while samples of both fathers were unavailable for analysis. Genomic DNA was extracted from peripheral blood samples using the QIAamp DNA Blood Kit (Qiagen, Germany). Exon 2 of the GJB2 gene was amplified by polymerase chain reaction (PCR) using the following primers: forward (5’ GGTGAGGTTGTGTAAGAGTTGG 3’) and reverse (5’ TGGGTTTTGATCTCCTCGAT 3’), which were designed by opensource Primer3 software.8 Bidirectional Sanger sequencing was performed by BigDye® Terminator v3.1 Cycle Sequencing kit (Life Technologies, USA) and sequencing data was analyzed using the BioEdit Sequence Alignment Editor.9 Detailed ophthalmological examination and follow up for both patients were done in April 2020 at the Clinic for Eye Disease, University Clinical Center of Serbia, Belgrade, Serbia. Both patients were treated with topical steroids (Prednisolone 0.5% q.i.d.) and artificial tears (HPMC 0.3% preservative free q.h.) for three months, and the therapy was intensified with topical Prednisolone 0.5% q.h. per day during the fourth month. Patients were followed up for six months.



Number 26
Number 26 VOL. 26(2), 2023 All in one
Number 26
VOL. 26(2), 2023
Number 26
VOL. 26, 2023 Supplement
Number 26
VOL. 26(1), 2023
Number 25
VOL. 25(2), 2022
Number 25
VOL. 25 (1), 2022
Number 24
VOL. 24(2), 2021
Number 24
VOL. 24(1), 2021
Number 23
VOL. 23(2), 2020
Number 22
VOL. 22(2), 2019
Number 22
VOL. 22(1), 2019
Number 22
VOL. 22, 2019 Supplement
Number 21
VOL. 21(2), 2018
Number 21
VOL. 21 (1), 2018
Number 21
VOL. 21, 2018 Supplement
Number 20
VOL. 20 (2), 2017
Number 20
VOL. 20 (1), 2017
Number 19
VOL. 19 (2), 2016
Number 19
VOL. 19 (1), 2016
Number 18
VOL. 18 (2), 2015
Number 18
VOL. 18 (1), 2015
Number 17
VOL. 17 (2), 2014
Number 17
VOL. 17 (1), 2014
Number 16
VOL. 16 (2), 2013
Number 16
VOL. 16 (1), 2013
Number 15
VOL. 15 (2), 2012
Number 15
VOL. 15, 2012 Supplement
Number 15
Vol. 15 (1), 2012
Number 14
14 - Vol. 14 (2), 2011
Number 14
The 9th Balkan Congress of Medical Genetics
Number 14
14 - Vol. 14 (1), 2011
Number 13
Vol. 13 (2), 2010
Number 13
Vol.13 (1), 2010
Number 12
Vol.12 (2), 2009
Number 12
Vol.12 (1), 2009
Number 11
Vol.11 (2),2008
Number 11
Vol.11 (1),2008
Number 10
Vol.10 (2), 2007
Number 10
10 (1),2007
Number 9
1&2, 2006
Number 9
3&4, 2006
Number 8
1&2, 2005
Number 8
3&4, 2004
Number 7
1&2, 2004
Number 6
3&4, 2003
Number 6
1&2, 2003
Number 5
3&4, 2002
Number 5
1&2, 2002
Number 4
Vol.3 (4), 2000
Number 4
Vol.2 (4), 1999
Number 4
Vol.1 (4), 1998
Number 4
3&4, 2001
Number 4
1&2, 2001
Number 3
Vol.3 (3), 2000
Number 3
Vol.2 (3), 1999
Number 3
Vol.1 (3), 1998
Number 2
Vol.3(2), 2000
Number 2
Vol.1 (2), 1998
Number 2
Vol.2 (2), 1999
Number 1
Vol.3 (1), 2000
Number 1
Vol.2 (1), 1999
Number 1
Vol.1 (1), 1998

 

 


 About the journal ::: Editorial ::: Subscription ::: Information for authors ::: Contact
 Copyright © Balkan Journal of Medical Genetics 2006