Balkan Journal of Medical Genetics

KERATITIS-ICHTHYOSIS-DEAFNESS SYNDROME WITH HETEROZYGOUS P.D50N IN THE GJB2 GENE IN TWO SERBIAN ADULT PATIENTS
Kalezić T.1,*, Vuković I.2, Stojković M.1, Stanojlović S.1, Karanović J.3, Brajušković G.3, Savić-Pavićević D.3
*Corresponding Author: Tanja Kalezić, School of Medicine, University of Belgrade; Clinic for Eye Disease, University Clinical Centre of Serbia, Address: Pasterova Street No 2 , Tel. +381638148843, e-mail address: tanjakalezic@gmail.com
page: 6

PATIENTS AND METHODS

Two unrelated patients with KID syndrome were studied. Clinical diagnosis was based on dermatological, hearing and ophthalmological examinations, and confirmed by molecular genetic analysis of the GJB2 gene. Molecular genetic testing for GJB2 mutations was done for both patients and their unaffected first-degree relatives (mother and sister), while samples of both fathers were unavailable for analysis. Genomic DNA was extracted from peripheral blood samples using the QIAamp DNA Blood Kit (Qiagen, Germany). Exon 2 of the GJB2 gene was amplified by polymerase chain reaction (PCR) using the following primers: forward (5’ GGTGAGGTTGTGTAAGAGTTGG 3’) and reverse (5’ TGGGTTTTGATCTCCTCGAT 3’), which were designed by opensource Primer3 software.8 Bidirectional Sanger sequencing was performed by BigDye® Terminator v3.1 Cycle Sequencing kit (Life Technologies, USA) and sequencing data was analyzed using the BioEdit Sequence Alignment Editor.9 Detailed ophthalmological examination and follow up for both patients were done in April 2020 at the Clinic for Eye Disease, University Clinical Center of Serbia, Belgrade, Serbia. Both patients were treated with topical steroids (Prednisolone 0.5% q.i.d.) and artificial tears (HPMC 0.3% preservative free q.h.) for three months, and the therapy was intensified with topical Prednisolone 0.5% q.h. per day during the fourth month. Patients were followed up for six months.

Number 25 VOL. 25(2), 2022	Number 25 VOL. 25 (1), 2022
Number 24 VOL. 24(2), 2021	Number 24 VOL. 24(1), 2021
Number 23 VOL. 23(2), 2020	Number 22 VOL. 22(2), 2019
Number 22 VOL. 22(1), 2019	Number 22 VOL. 22, 2019 Supplement
Number 21 VOL. 21(2), 2018	Number 21 VOL. 21 (1), 2018
Number 21 VOL. 21, 2018 Supplement	Number 20 VOL. 20 (2), 2017
Number 20 VOL. 20 (1), 2017	Number 19 VOL. 19 (2), 2016
Number 19 VOL. 19 (1), 2016	Number 18 VOL. 18 (2), 2015
Number 18 VOL. 18 (1), 2015	Number 17 VOL. 17 (2), 2014
Number 17 VOL. 17 (1), 2014	Number 16 VOL. 16 (2), 2013
Number 16 VOL. 16 (1), 2013	Number 15 VOL. 15 (2), 2012
Number 15 VOL. 15, 2012 Supplement	Number 15 Vol. 15 (1), 2012
Number 14 14 - Vol. 14 (2), 2011	Number 14 The 9th Balkan Congress of Medical Genetics
Number 14 14 - Vol. 14 (1), 2011	Number 13 Vol. 13 (2), 2010
Number 13 Vol.13 (1), 2010	Number 12 Vol.12 (2), 2009
Number 12 Vol.12 (1), 2009	Number 11 Vol.11 (2),2008
Number 11 Vol.11 (1),2008	Number 10 Vol.10 (2), 2007
Number 10 10 (1),2007	Number 9 1&2, 2006
Number 9 3&4, 2006	Number 8 1&2, 2005
Number 8 3&4, 2004	Number 7 1&2, 2004
Number 6 3&4, 2003	Number 6 1&2, 2003
Number 5 3&4, 2002	Number 5 1&2, 2002
Number 4 Vol.3 (4), 2000	Number 4 Vol.2 (4), 1999
Number 4 Vol.1 (4), 1998	Number 4 3&4, 2001
Number 4 1&2, 2001	Number 3 Vol.3 (3), 2000
Number 3 Vol.2 (3), 1999	Number 3 Vol.1 (3), 1998
Number 2 Vol.3(2), 2000	Number 2 Vol.1 (2), 1998
Number 2 Vol.2 (2), 1999	Number 1 Vol.3 (1), 2000
Number 1 Vol.2 (1), 1999	Number 1 Vol.1 (1), 1998

About the journal ::: Editorial ::: Subscription ::: Information for authors ::: Contact