PREVALENCE OF THE HEREDITARY HEMOCHROMATOSIS MUTATIONS (C282Y, H63D AND S65C) IN THE REPUBLIC OF MACEDONIA
Arsov T*, Petlichkovski A, Strezova A, Jurhar-Pavlova M, Trajkov D, Spiroski M
*Corresponding Author: : Dr. Todor Arsov, Institute of Immunobiology and Human Genetics, Institutes of the Faculty of Medicine, University in Skopje, Ul. “50 Divizija” No. 6, P.O. Box 60, 1109 Skopje, Republic of Macedonia; Tel: +389 2 110 556; Fax: +389 2 110 558; e-mail: todorarsov@hotmail.com
page: 11

MATERIALS AND METHODS

A total of 200 random DNA samples from healthy individuals (100 Macedonians, 50 Albanians and 50 Gypsies), provided by the Macedonian human DNA bank (hDNAMKD), Institute of Immunobiology and Human Genetics at Skopje, Republic of Macedonia, were genotyped for HFE mutations (C282Y, H63D and S65C). Written consent was obtained from each individual enrolled in this study. DNA was isolated from peripheral blood leukocytes by the phenol-chloroform extraction method [12]. The mutations were detected by a polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method [1,2,12]. Exon 4 was amplified in a 50 µL PCR reaction (MgCl2 1.5 µM, 2.5 U Taq Gold; Perkin Elmer, Roche Molecular Systems, Inc., Branchburg, NJ, USA; Tm 62EC, 40 cycles) and exon 2 in a 100 mL PCR reaction (MgCl2 2.0 µM, 2.5U Taq Gold; Perkin Elmer; Tm 62EC, 40 cycles), on a 96-well thermal cycler (PTC-100; MJ Research, Inc., Waltham, MA, USA) [14,15]. Twenty mL of the PCR products and 5 U of the corresponding restriction enzyme were used for the digestion reaction (buffer, temperature and time according to the manufacturer's recommendations; New England Biolabs (UK), Ltd., Hitchin, Hertfordshire, UK). The restriction fragments were visualized after electrophoresis in 3% agarose gel stained with ethidium bromide. The primers and restriction enzymes used are shown in Table 1. Quality control was ascertained by participation in the UK NEQAS HFE quality control scheme 5, 2001 (an international system of external quality control provided by UK NEQAS; 20 external quality control samples analyzed; accuracy result 100%).

Table 1. Primers and restriction enzymes used for the diagnosis of HFE mutations [8,14-16]

Mutation Forward Primer (5'÷3') Reverse Primer (5'÷3') Restriction
Enzyme
C282Y
 exon 4
TGGCAAGGGTAAACAGATCC CTCAGGCACTCCTCTCAACC RsaI; SnaBI
H63D
 exon 2
ACATGGTTAAGGCCTGTTGC CTTGCTGTGGTTGTGATTTTCC MboI, BclI
S65C
 exon 2
ACATGGTTAAGGCCTGTTGC CTTGCTGTGGTTGTGATTTTCC HinfI




Number 28
Vol 28 2025 Supplement
Number 27
VOL. 27 (2), 2024
Number 27
VOL. 27 (1), 2024
Number 26
Number 26 VOL. 26(2), 2023 All in one
Number 26
VOL. 26(2), 2023
Number 26
VOL. 26, 2023 Supplement
Number 26
VOL. 26(1), 2023
Number 25
VOL. 25(2), 2022
Number 25
VOL. 25 (1), 2022
Number 24
VOL. 24(2), 2021
Number 24
VOL. 24(1), 2021
Number 23
VOL. 23(2), 2020
Number 22
VOL. 22(2), 2019
Number 22
VOL. 22(1), 2019
Number 22
VOL. 22, 2019 Supplement
Number 21
VOL. 21(2), 2018
Number 21
VOL. 21 (1), 2018
Number 21
VOL. 21, 2018 Supplement
Number 20
VOL. 20 (2), 2017
Number 20
VOL. 20 (1), 2017
Number 19
VOL. 19 (2), 2016
Number 19
VOL. 19 (1), 2016
Number 18
VOL. 18 (2), 2015
Number 18
VOL. 18 (1), 2015
Number 17
VOL. 17 (2), 2014
Number 17
VOL. 17 (1), 2014
Number 16
VOL. 16 (2), 2013
Number 16
VOL. 16 (1), 2013
Number 15
VOL. 15 (2), 2012
Number 15
VOL. 15, 2012 Supplement
Number 15
Vol. 15 (1), 2012
Number 14
14 - Vol. 14 (2), 2011
Number 14
The 9th Balkan Congress of Medical Genetics
Number 14
14 - Vol. 14 (1), 2011
Number 13
Vol. 13 (2), 2010
Number 13
Vol.13 (1), 2010
Number 12
Vol.12 (2), 2009
Number 12
Vol.12 (1), 2009
Number 11
Vol.11 (2),2008
Number 11
Vol.11 (1),2008
Number 10
Vol.10 (2), 2007
Number 10
10 (1),2007
Number 9
1&2, 2006
Number 9
3&4, 2006
Number 8
1&2, 2005
Number 8
3&4, 2004
Number 7
1&2, 2004
Number 6
3&4, 2003
Number 6
1&2, 2003
Number 5
3&4, 2002
Number 5
1&2, 2002
Number 4
Vol.3 (4), 2000
Number 4
Vol.2 (4), 1999
Number 4
Vol.1 (4), 1998
Number 4
3&4, 2001
Number 4
1&2, 2001
Number 3
Vol.3 (3), 2000
Number 3
Vol.2 (3), 1999
Number 3
Vol.1 (3), 1998
Number 2
Vol.3(2), 2000
Number 2
Vol.1 (2), 1998
Number 2
Vol.2 (2), 1999
Number 1
Vol.3 (1), 2000
Number 1
Vol.2 (1), 1999
Number 1
Vol.1 (1), 1998

 

 


 About the journal ::: Editorial ::: Subscription ::: Information for authors ::: Contact
 Copyright © Balkan Journal of Medical Genetics 2006