ONRAT T.S1, Ellidokuz E2.,Küpelioğlu A3., Durhan E1., 1. Department of Biology , Molecular Biology, Afyon Kocatepe University Science Faculty, Afyon, Turkey. 2. Department of Internal Medicine and Gastroenterology, School of Medicine, Celal Bayar University , Manisa, Turkey. 3. Güneş Patology Laboratuary, Alsancak, İzmir, Turkey. e-mail: tutgunonrat@yahoo.com
*Corresponding Author:
page: 66


Colorectal carcinomas are characterized by multiple genetic aberrations that occur during tumorigenesis. So far, molecular genetic studies revealed that a group of tumor suppressor gene and proto-oncogene alterations were effective in cancer formation. Several tumor suppressor gene associated with colorectal carcinoma have been identified. p53 is the most important tumor suppressor gene that is effective in cancer formation. We have observed that PCR-RFLP genotyping for the   codon 72 exon 4 polymorphism (Arg72Pro) of the p53 gene. In this study, DNA was isolated from colon cancer tissue samples of (19 females and 16 males) 35 cases diagnosed to be colon carcinoma. Tissues were collected from 35 cases with  colon cancer  ages of female 40-90 (mean age 65.95±2.76) and ages of male 40-79(mean age 61.67±3.07). Genomic DNA was extracted from paraffin embedded tissues using EZNA Tissue DNA Kit (Omega) following the protocol. According to the exon 4 sequence primers P1(5’TTGCC GTCCCAAGCAATGGATGA3’) and P2(5’TCTGGGAAGGGACAGAAGATGAC3’) (MWG-BIOTECH)  were designed. 5 µl DNA amplified in a reaction ,that contained 0.2 µmol dNTP mix (Dr.Zeydanlı) , 0.5 unit Taq DNA polimerase (BIORON)  and primers , with a total volume of 50 µl. The PCR was performed with 10pmol 0.5µl (P1+P2) for 36 cycles ( predenaturing  for 5 min at 95°C, denaturing for 30 second  at  95°C, annealing  for 30 second  at 59°C  and extension for 35 second at 72°C)  in thermal cycler (Primus 96 Advanced, Peqlab) for  amplification product of 199 bp. 15 µl of  PCR products was dilueted with 4 μl of 6X loading dye (Dr.Zeydanlı)  and separated in %1 agarose gel (Serva) stained with ethidium bromide (Dr.Zeydanlı) and observed under UV-Light transilluminator (CSL). After then 4th exon of p53 were amplified by PCR method and p53 mutation analyses was performed using by BstFNI restriction enzyme determined for 4th exon. In this study, we found that mutations were present in 27(%77.1) of 35 cases enrolled into study. Corresponding statistical analysis in 14 (51.9%) cases Arg/Arg , 11(40.7%) cases Arg/Pro and 2(7.4%) Pro/Pro genotypes were found. In 8(22.9%) were not obtained DNA isolation. Our results indicate that individuals homozygous for the Arg allele have high frequency than other alleles and according to the this statistical results that colon cancer may be related  Arg allel frequency.

Number 19
VOL. 19 (2), 2016
Number 19
VOL. 19 (1), 2016
Number 18
VOL. 18 (2), 2015
Number 18
VOL. 18 (1), 2015
Number 17
VOL. 17 (2), 2014
Number 17
VOL. 17 (1), 2014
Number 16
VOL. 16 (2), 2013
Number 16
VOL. 16 (1), 2013
Number 15
VOL. 15 (2), 2012
Number 15
VOL. 15, 2012 Supplement
Number 15
Vol. 15 (1), 2012
Number 14
14 - Vol. 14 (2), 2011
Number 14
The 9th Balkan Congress of Medical Genetics
Number 14
14 - Vol. 14 (1), 2011
Number 13
Vol. 13 (2), 2010
Number 13
Vol.13 (1), 2010
Number 12
Vol.12 (2), 2009
Number 12
Vol.12 (1), 2009
Number 11
Vol.11 (2),2008
Number 11
Vol.11 (1),2008
Number 10
Vol.10 (2), 2007
Number 10
10 (1),2007
Number 9
1&2, 2006
Number 9
3&4, 2006
Number 8
1&2, 2005
Number 8
3&4, 2004
Number 7
1&2, 2004
Number 6
3&4, 2003
Number 6
1&2, 2003
Number 5
3&4, 2002
Number 5
1&2, 2002
Number 4
Vol.3 (4), 2000
Number 4
Vol.2 (4), 1999
Number 4
Vol.1 (4), 1998
Number 4
3&4, 2001
Number 4
1&2, 2001
Number 3
Vol.3 (3), 2000
Number 3
Vol.2 (3), 1999
Number 3
Vol.1 (3), 1998
Number 2
Vol.3(2), 2000
Number 2
Vol.1 (2), 1998
Number 2
Vol.2 (2), 1999
Number 1
Vol.3 (1), 2000
Number 1
Vol.2 (1), 1999
Number 1
Vol.1 (1), 1998



 About the journal ::: Editorial ::: Subscription ::: Information for authors ::: Contact
 Copyright © Balkan Journal of Medical Genetics 2006