
PP42. P53 Intronic variant G13964C analyses in cases with colon cancer Onrat T.S1, Ellidokuz E2.,Küpelioğlu A3., Durhan E1.,
1. Department of Biology , Molecular Biology, Afyon Kocatepe University Science Faculty, Afyon, Turkey. 2. Department of Internal Medicine and Gastroenterology, School of Medicine, Celal Bayar University , Manisa, Turkey. 3. Güneş Patology Laboratuary, Alsancak, İzmir, Turkey.
e-mail: tutgunonrat@yahoo.com
*Corresponding Author: page: 65
|
|
Abstract
Inactivation of p53 is the most common change identified in human cancer. Nucleotide alterations in p53 intron 6 have been reported to be associated with the dysregulation of p53 function and tumor development. G13964C base change functioned as dominant mutation similar to the more common missense, nonsense and splice-site mutations. To detect the G13964C variant PCR-RFLP assay was used. In this study, DNA was isolated from colon cancer tissue samples of (19 females and 16 males)35 cases diagnosed to be colon carcinoma. Tissues were collected from 35 cases with colon cancer ages of female 40-90(mean age 65.95±2.76) and ages of male 40-79(mean age 61.67±3.07).
Genomic DNA was extracted from parafin embedded tissues using EZNA Tissue DNA Kit (Omega) following the protocol. According to the exon 4 sequence primers P1(5CTCCCCTGCTTGCCACAGGT3) and P2(5CAGTGTGCAGGGTGGCAAGT3) (MWG-BIOTECH) were designed. 5 µl DNA amplified in a reaction, that contained 0.2 µmol dNTP mix (Dr.Zeydanlı) , 0.5 unit Taq DNA polimerase (BIORON) and primers , with a total volume of 50 µl. The PCR was performed with 10pmol 0.5 µl (P1+ P2) for 36 cycles ( predenaturing for 5 min at 95°C, denaturing for 30 second at 95°C , annealing for 30 second at 59°C and extension for 35 second at 72°C) in thermal cycler (Primus 96 Advanced, Peqlab) for amplification product of 207 bp. 15 µl of PCR products was dilueted with 4 μl of 6X loading dye (Dr.Zeydanlı) and separated in %1 agarose gel (Serva) stained with ethidium bromide (Dr.Zeydanlı) and observed under UV-Light transilluminator (CSL). After then 7th exon of p53 were amplified by PCR method and p53 mutation analyses was performed using by BstHHI restriction enzyme determined for 7th exon.
In this study, we found that mutations were present in 30 (85.7%) of 35 cases enrolled into study. Corresponding statistical analysis in 7 (23.3%) cases G/G , 21 (70.0%) cases G/C and 2(6.7%) C/C genotypes were found. In 5 (14.3%) were not obtained DNA isolation.
Our results indicate that individuals heterozygotes for the GC allele have high frequency than other alleles and according to the this statistical results that colon cancer may be related GC allel frequency.
|
|
|
|



 |
Number 28 Vol 28 2025 Supplement |
Number 27 VOL. 27 (2), 2024 |
Number 27 VOL. 27 (1), 2024 |
Number 26 Number 26 VOL. 26(2), 2023 All in one |
Number 26 VOL. 26(2), 2023 |
Number 26 VOL. 26, 2023 Supplement |
Number 26 VOL. 26(1), 2023 |
Number 25 VOL. 25(2), 2022 |
Number 25 VOL. 25 (1), 2022 |
Number 24 VOL. 24(2), 2021 |
Number 24 VOL. 24(1), 2021 |
Number 23 VOL. 23(2), 2020 |
Number 22 VOL. 22(2), 2019 |
Number 22 VOL. 22(1), 2019 |
Number 22 VOL. 22, 2019 Supplement |
Number 21 VOL. 21(2), 2018 |
Number 21 VOL. 21 (1), 2018 |
Number 21 VOL. 21, 2018 Supplement |
Number 20 VOL. 20 (2), 2017 |
Number 20 VOL. 20 (1), 2017 |
Number 19 VOL. 19 (2), 2016 |
Number 19 VOL. 19 (1), 2016 |
Number 18 VOL. 18 (2), 2015 |
Number 18 VOL. 18 (1), 2015 |
Number 17 VOL. 17 (2), 2014 |
Number 17 VOL. 17 (1), 2014 |
Number 16 VOL. 16 (2), 2013 |
Number 16 VOL. 16 (1), 2013 |
Number 15 VOL. 15 (2), 2012 |
Number 15 VOL. 15, 2012 Supplement |
Number 15 Vol. 15 (1), 2012 |
Number 14 14 - Vol. 14 (2), 2011 |
Number 14 The 9th Balkan Congress of Medical Genetics |
Number 14 14 - Vol. 14 (1), 2011 |
Number 13 Vol. 13 (2), 2010 |
Number 13 Vol.13 (1), 2010 |
Number 12 Vol.12 (2), 2009 |
Number 12 Vol.12 (1), 2009 |
Number 11 Vol.11 (2),2008 |
Number 11 Vol.11 (1),2008 |
Number 10 Vol.10 (2), 2007 |
Number 10 10 (1),2007 |
Number 9 1&2, 2006 |
Number 9 3&4, 2006 |
Number 8 1&2, 2005 |
Number 8 3&4, 2004 |
Number 7 1&2, 2004 |
Number 6 3&4, 2003 |
Number 6 1&2, 2003 |
Number 5 3&4, 2002 |
Number 5 1&2, 2002 |
Number 4 Vol.3 (4), 2000 |
Number 4 Vol.2 (4), 1999 |
Number 4 Vol.1 (4), 1998 |
Number 4 3&4, 2001 |
Number 4 1&2, 2001 |
Number 3 Vol.3 (3), 2000 |
Number 3 Vol.2 (3), 1999 |
Number 3 Vol.1 (3), 1998 |
Number 2 Vol.3(2), 2000 |
Number 2 Vol.1 (2), 1998 |
Number 2 Vol.2 (2), 1999 |
Number 1 Vol.3 (1), 2000 |
Number 1 Vol.2 (1), 1999 |
Number 1 Vol.1 (1), 1998 |
|
|
|